View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19700_low_16 (Length: 313)
Name: NF19700_low_16
Description: NF19700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19700_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 302
Target Start/End: Original strand, 224685 - 224970
Alignment:
| Q |
18 |
attgtctcatcaacttcagtgtttgcattgcattgcctaagatttaagatttagggggtgagttagatacaaattagaggcaacatggcaatcagtcaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
224685 |
attgtctcatcaacttcagtgtttgcattgcattgcctaagatttaagatttagggggtgagttagatacaaattagaggcaacatggcaatcagtcaca |
224784 |
T |
|
| Q |
118 |
acactttggcatttgcctttggcatgctaggtaggatatctcatgcattc-nnnnnnnttgatcaatatttccaatccattttatattagtgatatgaga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
224785 |
acactttggcatttgcctttggcatgctaggtaggatatctcatgcattcaaaaaaaattgatcaatatttccaatccattttatattagtgatatgaga |
224884 |
T |
|
| Q |
217 |
caaattataatatatcatatttctagcatctcatttgtattgaataaattaaagaattaatttatttttctttttgatgcacaggt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
224885 |
caaattataatatatcatatttctagcatctcatttgtattgaataaattaaagaattaatttatttttctttttgatgcacaggt |
224970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 238722 - 238773
Alignment:
| Q |
99 |
aacatggcaatcagtcacaacactttggcatttgcctttggcatgctaggta |
150 |
Q |
| |
|
|||||||| || ||||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
238722 |
aacatggccattagtcacaacactttggcttttacctttggcatgcttggta |
238773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University