View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19700_low_23 (Length: 255)
Name: NF19700_low_23
Description: NF19700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19700_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 42833780 - 42834007
Alignment:
| Q |
18 |
ttattatgtatctcagtttttaaattgattttctttcatggtgatactttgctatttttgtttatggtagaatttagatttgttttataacctaggaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42833780 |
ttattatgtatctcagtttttaaattgattttctttcatggtgatactttgctatttttgtttatggtagaatttagatttgttttataacctaggaaaa |
42833879 |
T |
|
| Q |
118 |
caaatttacatttcaaaattgcaatccaaatttacatttcatgtcattatacctatatgttcatgaccttttattatggaatagaaaaattgtacctttt |
217 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42833880 |
caaatttaaatttcaaaattgcaatccaaatttacatttcatgtcattatatctatatgttcatgaccttttattatggaatagaaaaattgtacctttt |
42833979 |
T |
|
| Q |
218 |
tatggnnnnnnnctaacgcattgttctt |
245 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
42833980 |
tatggtttttttctaacgcattgttctt |
42834007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University