View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19701_high_2 (Length: 210)
Name: NF19701_high_2
Description: NF19701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19701_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 24 - 200
Target Start/End: Complemental strand, 31954251 - 31954075
Alignment:
| Q |
24 |
gcacatcttgctacaggtgtggtggggttggtcacatagcaagagattgcgctactcctagtagcggaggtggtggaggcggcgcctgctataagtgcgg |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31954251 |
gcacatcttgctacaggtgtggtggggttggtcacatagcaagagattgcgctactcctagtagcggaggtggtggaggcggcgcttgctataagtgcgg |
31954152 |
T |
 |
| Q |
124 |
tgaggtgggtcacatagctagggattgcagcaatgaagggggaaggtttgatggtggcaatggaaagtatgatgatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31954151 |
tgaggtgggtcacatagctagggattgcagcaatgaaggaggaaggtttgatggtggcaatggaaggtatgatgatg |
31954075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University