View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19701_low_2 (Length: 210)

Name: NF19701_low_2
Description: NF19701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19701_low_2
NF19701_low_2
[»] chr8 (1 HSPs)
chr8 (24-200)||(31954075-31954251)


Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 24 - 200
Target Start/End: Complemental strand, 31954251 - 31954075
Alignment:
24 gcacatcttgctacaggtgtggtggggttggtcacatagcaagagattgcgctactcctagtagcggaggtggtggaggcggcgcctgctataagtgcgg 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
31954251 gcacatcttgctacaggtgtggtggggttggtcacatagcaagagattgcgctactcctagtagcggaggtggtggaggcggcgcttgctataagtgcgg 31954152  T
124 tgaggtgggtcacatagctagggattgcagcaatgaagggggaaggtttgatggtggcaatggaaagtatgatgatg 200  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||    
31954151 tgaggtgggtcacatagctagggattgcagcaatgaaggaggaaggtttgatggtggcaatggaaggtatgatgatg 31954075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University