View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19702_high_16 (Length: 242)
Name: NF19702_high_16
Description: NF19702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19702_high_16 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 242
Target Start/End: Complemental strand, 7868383 - 7868156
Alignment:
| Q |
17 |
tattggtgattctacgattccactagataatggtggtttagtgataaaaacaggaactaaaa--ggtttagtttataggcagcatgaatgtaaaagtaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7868383 |
tattggtgattctacgattccactagataatggtggtttagtgataaaaacaggaactaaaaaaggtatagtttataggcagcatgaatgtaaaagtaat |
7868284 |
T |
 |
| Q |
115 |
attcaacaaatcatagattcatttgattaatggtacgtatacggataccccactcattgttcctttgaaatatagaacattttgcataagcatataggcc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
7868283 |
attcaacaaatcatagattcatttgattaatggtacgtatacggataccccactcattgttcctttgaagtatagaacattttgaataagcatataggcc |
7868184 |
T |
 |
| Q |
215 |
caagcatatatagtgcaagtgtagcata |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7868183 |
caagcatatatagtgcaagtgtagcata |
7868156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University