View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19702_low_13 (Length: 262)
Name: NF19702_low_13
Description: NF19702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19702_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 36 - 153
Target Start/End: Complemental strand, 39299679 - 39299562
Alignment:
| Q |
36 |
atgaacagaggaatgggaacaggacaagttgtggccgagaaaggaagaaaaacagaggatttaggaacaagaggtgaaggaaaagtacctggtgctggaa |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299679 |
atgaacagaggaatgggaacaggacaagttgtggcagagaaaggaagaaaaacagaggatttaggaacaagaggtgaaggaaaagtacctggtgctggaa |
39299580 |
T |
 |
| Q |
136 |
atgtaggttcaatgtggg |
153 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
39299579 |
atgtaggttcgatgtggg |
39299562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University