View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19704_high_14 (Length: 253)
Name: NF19704_high_14
Description: NF19704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19704_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 25 - 235
Target Start/End: Original strand, 12919730 - 12919945
Alignment:
| Q |
25 |
cctctggttggcagaatgtcgcgggccagtcgccacaaaaagtttctagtaca-----gtttggagcatgcattttccagactgctctccaaagcctttg |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12919730 |
cctctggttggcagaatgttgcgggccagtcgccacaaaaagtttctagtcctagcctgtttggagcatgcattttccagtctgctctccaaagcctttg |
12919829 |
T |
 |
| Q |
120 |
gtcaatcatagaagaagcttcagggttctctctactgttgtcatcttgtatcgaatggtaagccgaacgcacagagtaattaccatttctttcccaatgc |
219 |
Q |
| |
|
|||| ||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12919830 |
gtcactcaaagatgaagcttcagggttctctctactgttgtcatcttgtatcgaatggtaagccgaacgcacagagtaattaccatttctttcccaatgc |
12919929 |
T |
 |
| Q |
220 |
aaaatccttttatcct |
235 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
12919930 |
aaaatccttttatcct |
12919945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University