View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19704_high_20 (Length: 208)
Name: NF19704_high_20
Description: NF19704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19704_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 55; Significance: 8e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 66 - 124
Target Start/End: Complemental strand, 47957290 - 47957232
Alignment:
| Q |
66 |
attgttcggacctttagattctctcacaagggtctcgtatctgcaaaccagactcgtac |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47957290 |
attgttcggacctttagattctctcacaagggtctcgtatctgcaaacgagactcgtac |
47957232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 47957340 - 47957306
Alignment:
| Q |
1 |
atataaaagtttacaacttatttttgacagatata |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
47957340 |
atataaaagtttacaacttatttttgacagatata |
47957306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University