View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19704_low_14 (Length: 333)
Name: NF19704_low_14
Description: NF19704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19704_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 317
Target Start/End: Original strand, 35352496 - 35352813
Alignment:
| Q |
1 |
aataaagatgacgacaactctcaaacaaatgtggttagaactattaaattacagaggtgattgttaaaccagaattggtgatcggttctacttccccaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35352496 |
aataaagatgacgacaactctcaaacaaatgtggttagaactattaaattacagaggtgattgttaaaccagaattggtgatcggttctacttccccaat |
35352595 |
T |
 |
| Q |
101 |
acacatttgc-aagattgaggatattcgacaccttaaagactaatggcgtgtttggggatttcaagttaggaaatggtaacataatcgatgttgaagaca |
199 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35352596 |
gcacatttgccaagattgaggatattcgacaccttaaagactaatggcatgtttggggatttcaagttaggaaatggtaacataatcgatgttgaaggca |
35352695 |
T |
 |
| Q |
200 |
ttgagagtgtgatactaaagttccacgatgctgcagttcatatgtcccaggatgcaaggttgttgatgccaacatcgtctctttggagagatgaaatcac |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35352696 |
ttgagagtgtgatactaaagttccacgatgctgcagttcatatgtcccaggatgcaaggttgttgatgccaacatcgtctctttggagagatgaaatcac |
35352795 |
T |
 |
| Q |
300 |
ttgagtagaagttcgatg |
317 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35352796 |
ttgagtagaagttcgatg |
35352813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University