View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19704_low_25 (Length: 203)
Name: NF19704_low_25
Description: NF19704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19704_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 49 - 184
Target Start/End: Original strand, 46633305 - 46633440
Alignment:
| Q |
49 |
cttcttatattcattgtttgtactgtctgtgaattacatttgtgtgaaggatttgtaatggttttttgtcatgtataaatgttaccaagttagatatatt |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46633305 |
cttcttatattcattgtttgtactgtctgtgaattacatttgtgtgaaggatttgtaatggttttttgtcatgtataaatgttaccaagttagatatatt |
46633404 |
T |
 |
| Q |
149 |
tcagaacagcactgttttactaaagagttgtttatt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
46633405 |
tcagaacagcactgttttactaaagagttgtttatt |
46633440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University