View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19705_low_5 (Length: 287)
Name: NF19705_low_5
Description: NF19705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19705_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 21 - 155
Target Start/End: Complemental strand, 35228678 - 35228544
Alignment:
| Q |
21 |
aaattatgctaattaagatgatgttgattcttgtttataggtagttgttgggcatttgcaattgtggctgcaatagaaggtattcatcaaataaccacag |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228678 |
aaattatgctaattaagatgatgttgattcttgtttataggtagttgttgggcatttgcaactgtggctgcaatagaaggtattcatcaaataaccacag |
35228579 |
T |
 |
| Q |
121 |
gaagattagtatcactctctgagcaagagctagtg |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228578 |
gaagattagtatcactctctgagcaagagctagtg |
35228544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 152 - 267
Target Start/End: Original strand, 35228563 - 35228678
Alignment:
| Q |
152 |
agtgatactaatcttcctgtggttatttgatgaataccttctattgcagccacaattgcaaatgcccaacaactacctataaacaagaatcaacatcatc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228563 |
agtgatactaatcttcctgtggttatttgatgaataccttctattgcagccacagttgcaaatgcccaacaactacctataaacaagaatcaacatcatc |
35228662 |
T |
 |
| Q |
252 |
ttaattagcataattt |
267 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35228663 |
ttaattagcataattt |
35228678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 232
Target Start/End: Original strand, 31176914 - 31176979
Alignment:
| Q |
167 |
cctgtggttatttgatgaataccttctattgcagccacaattgcaaatgcccaacaactacctata |
232 |
Q |
| |
|
||||| |||||||| || ||||| ||||| | ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
31176914 |
cctgttgttatttggtggataccctctatggaagccacagttgaaaatgcccaacaactacctata |
31176979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 56 - 121
Target Start/End: Complemental strand, 31176979 - 31176914
Alignment:
| Q |
56 |
tataggtagttgttgggcatttgcaattgtggctgcaatagaaggtattcatcaaataaccacagg |
121 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||| | ||||| ||||| || |||||||| ||||| |
|
|
| T |
31176979 |
tataggtagttgttgggcattttcaactgtggcttccatagagggtatccaccaaataacaacagg |
31176914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 117
Target Start/End: Original strand, 29746533 - 29746586
Alignment:
| Q |
64 |
gttgttgggcatttgcaattgtggctgcaatagaaggtattcatcaaataacca |
117 |
Q |
| |
|
|||||||||||||| | | |||||||||||||||||||| || |||||||||| |
|
|
| T |
29746533 |
gttgttgggcattttctacggtggctgcaatagaaggtatccaacaaataacca |
29746586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 224
Target Start/End: Complemental strand, 29746586 - 29746533
Alignment:
| Q |
171 |
tggttatttgatgaataccttctattgcagccacaattgcaaatgcccaacaac |
224 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
29746586 |
tggttatttgttggataccttctattgcagccaccgtagaaaatgcccaacaac |
29746533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University