View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19705_low_6 (Length: 287)
Name: NF19705_low_6
Description: NF19705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19705_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 110 - 271
Target Start/End: Complemental strand, 28190513 - 28190353
Alignment:
| Q |
110 |
gattctctataataatatatacgtccaaaatttgtgacaatattacaacaagctcacagatatacagataaaaaatactataacattaaatgtaacgaga |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28190513 |
gattctctataataatatatacgtccaaaatttgtgacaatattacagcaagctcacagatatacagataaaaa-tactataacattaaatgtaacgaga |
28190415 |
T |
 |
| Q |
210 |
tggaagctactgttcctttgcactgcatgagagattcatatagctatgattgtacatgttta |
271 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28190414 |
tggcagctactgttcctttgcactgcatgagagattcatatagctatgattgtacatgttta |
28190353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 44
Target Start/End: Complemental strand, 28190613 - 28190579
Alignment:
| Q |
10 |
attattctgagtgctaatataagatttaaacttag |
44 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
28190613 |
attattatgagtgctaatataagatttaaacttag |
28190579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University