View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19705_low_6 (Length: 287)

Name: NF19705_low_6
Description: NF19705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19705_low_6
NF19705_low_6
[»] chr7 (2 HSPs)
chr7 (110-271)||(28190353-28190513)
chr7 (10-44)||(28190579-28190613)


Alignment Details
Target: chr7 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 110 - 271
Target Start/End: Complemental strand, 28190513 - 28190353
Alignment:
110 gattctctataataatatatacgtccaaaatttgtgacaatattacaacaagctcacagatatacagataaaaaatactataacattaaatgtaacgaga 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||    
28190513 gattctctataataatatatacgtccaaaatttgtgacaatattacagcaagctcacagatatacagataaaaa-tactataacattaaatgtaacgaga 28190415  T
210 tggaagctactgttcctttgcactgcatgagagattcatatagctatgattgtacatgttta 271  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28190414 tggcagctactgttcctttgcactgcatgagagattcatatagctatgattgtacatgttta 28190353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 44
Target Start/End: Complemental strand, 28190613 - 28190579
Alignment:
10 attattctgagtgctaatataagatttaaacttag 44  Q
    |||||| ||||||||||||||||||||||||||||    
28190613 attattatgagtgctaatataagatttaaacttag 28190579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University