View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19706_high_10 (Length: 249)

Name: NF19706_high_10
Description: NF19706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19706_high_10
NF19706_high_10
[»] chr7 (1 HSPs)
chr7 (1-235)||(2730060-2730293)


Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 2730293 - 2730060
Alignment:
1 aaaataattttctggatgatcaggaaaagagcggtaaatggggtcctaggttgacaacagtgccaattatagtgcaaaagctggcacaagaaagagaagt 100  Q
    ||||||||||||||||||||||||||||||| ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2730293 aaaataattttctggatgatcaggaaaagaggggcgaatggggtcctaggttgacaacagtgccaattatagtgcaaaagctggcacaagaaagagaagt 2730194  T
101 tgagcagagggagaagacctatgagttgtctacaacatgtgatgtgagggaaggaggtatgtttcacgcaactttatgggatttgggtgttgtttacatg 200  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||||||||| |||||    
2730193 tgagcagagggagaagacctatgaggtgtctacaacatgtgatgtgagggaaggaggtatgtttcacgcaactttgtggggtgtgggtgttgttcacatg 2730094  T
201 tttgacttggggaaggaggcacatatgggtctgat 235  Q
    | ||||||||||||||| ||||||  |||||||||    
2730093 tctgacttggggaagga-gcacatgcgggtctgat 2730060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University