View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19706_high_11 (Length: 236)
Name: NF19706_high_11
Description: NF19706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19706_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 7354415 - 7354635
Alignment:
| Q |
1 |
aaaaccggtgaggtgactgcaacaatggtagacctccaatgtcttcgtccccctcggcagatatctcccttggtaatatcaaaactcgtaaaacaatcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7354415 |
aaaaccggtgaggtgactgcaacaatggcagacctccaatgtcttcgtccccctcggcagatatctcccttggtaatatcaaaacttgtaaaacaatcat |
7354514 |
T |
 |
| Q |
101 |
ttttcattttggtacttaataattttgattggcatattaacttatgaattggttgatgttattttttattaaattatgcaactaaatgctgaaaggttgc |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7354515 |
tttttattttggtacttaataattttgattggcatattaacttatgaattggttgatgttattttttattagattatgcaactaaatgctgaaaggttgc |
7354614 |
T |
 |
| Q |
201 |
gctttgaacaagaggaaaata |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7354615 |
gctttgaacaagaggaaaata |
7354635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 76 - 218
Target Start/End: Original strand, 15493853 - 15493995
Alignment:
| Q |
76 |
atatcaaaactcgtaaaacaatcatttttcattttggtacttaataattttgattggcatattaacttatgaattggttgatgttattttttattaaatt |
175 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| || ||| ||||||| |||||||||||||||||||||| ||| || | |||||| ||| |
|
|
| T |
15493853 |
atatcaaaactcgtaaaacaattatttttcattttgaccattcatatttttgatcaacatattaacttatgaattggttattgtcatctgttattagatt |
15493952 |
T |
 |
| Q |
176 |
atgcaactaaatgctgaaaggttgcgctttgaacaagaggaaa |
218 |
Q |
| |
|
||||||||||| || ||| |||||| || |||||||| |||| |
|
|
| T |
15493953 |
atgcaactaaacactaaaatgttgcgtttcgaacaagaagaaa |
15493995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University