View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19706_low_10 (Length: 249)
Name: NF19706_low_10
Description: NF19706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19706_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 2730293 - 2730060
Alignment:
| Q |
1 |
aaaataattttctggatgatcaggaaaagagcggtaaatggggtcctaggttgacaacagtgccaattatagtgcaaaagctggcacaagaaagagaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2730293 |
aaaataattttctggatgatcaggaaaagaggggcgaatggggtcctaggttgacaacagtgccaattatagtgcaaaagctggcacaagaaagagaagt |
2730194 |
T |
 |
| Q |
101 |
tgagcagagggagaagacctatgagttgtctacaacatgtgatgtgagggaaggaggtatgtttcacgcaactttatgggatttgggtgttgtttacatg |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||||||||| ||||| |
|
|
| T |
2730193 |
tgagcagagggagaagacctatgaggtgtctacaacatgtgatgtgagggaaggaggtatgtttcacgcaactttgtggggtgtgggtgttgttcacatg |
2730094 |
T |
 |
| Q |
201 |
tttgacttggggaaggaggcacatatgggtctgat |
235 |
Q |
| |
|
| ||||||||||||||| |||||| ||||||||| |
|
|
| T |
2730093 |
tctgacttggggaagga-gcacatgcgggtctgat |
2730060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University