View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19706_low_3 (Length: 401)
Name: NF19706_low_3
Description: NF19706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19706_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 181 - 390
Target Start/End: Original strand, 52234113 - 52234327
Alignment:
| Q |
181 |
tgacatattcgcgtgcggttcattcctaacaaatactagctcataatattgatatttcctaaaatctctctacaaatacaatca----catgtcttaatt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52234113 |
tgacatattcgcgtgcggttcattcctaacaaatactagctcataatattgatagttcctaaaatctctctacaaatacaatcatctacatgtcttaatt |
52234212 |
T |
|
| Q |
277 |
atgccaatttatcatattaatagttcctaaattctctctaatgtacaggtaaaatggaattattagatgtaatgtgtccataaatc-ttttcaaatcaca |
375 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
52234213 |
atgccaatttatcatattaatagttcctagattctctctaatgtacaggtaaaatggaattattagatgtaatgtatgcataaatctttttcaaatcaca |
52234312 |
T |
|
| Q |
376 |
attaaactgcatatt |
390 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52234313 |
attaaactgcatatt |
52234327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 18 - 129
Target Start/End: Original strand, 52233999 - 52234112
Alignment:
| Q |
18 |
atatctgatcatatatcacatgccaaaattattttggaaaatggttaatcactaataaaatctcacaaaccatcaaac--ataaaaactcaccaatcgaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52233999 |
atatctgatcatatatcacatgccaaaattattttggaaaatggttaatcactgataaaatctcacaaaccatcaaacatataaaaactcaccaatcgaa |
52234098 |
T |
|
| Q |
116 |
ataaaccgtttggc |
129 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52234099 |
ataaaccgtttggc |
52234112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University