View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19707_high_21 (Length: 361)
Name: NF19707_high_21
Description: NF19707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19707_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 16 - 343
Target Start/End: Complemental strand, 30075130 - 30074803
Alignment:
| Q |
16 |
atagcacatggacgctctctcccagcacacaaaaagaaatgtctttgtgcaatgacagtgaaactttacatcaagtatgagtgaataaacttctgagaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30075130 |
atagcacatggacgctctctcccagcacacaaaaagaaatgtctttgtgcgatgacagtgaaactttacatcaagcatgagtgaataaacttctgagaat |
30075031 |
T |
 |
| Q |
116 |
gcacaaagggagcacaactttgcagatttacgtgggcacaaactccctggaattgggctctaaattagacacaataagccaaaggaccaagattaacagc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30075030 |
gcacaaagggagcacaactttgcagatttacgtgggcacaaactccctggaattgggctctaaattagacaaaataagccaaaggaccaagattaacagc |
30074931 |
T |
 |
| Q |
216 |
atgaactgtaagacaaagcagtatgtcaggttgcataatctcctctgaatcataaaagtctcctcagctcctaaaacttcaccacggtattttcctgatt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30074930 |
atgaactgtaagacaaagcagtatgtcaggttgcataatctcctctgaatcataaaagtctcctcagctcctaaaacttcaccacggtattttcctgatt |
30074831 |
T |
 |
| Q |
316 |
catctgttctgttcttcattattgaatc |
343 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
30074830 |
catctgttctgttcttcattattgaatc |
30074803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University