View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19707_high_29 (Length: 301)
Name: NF19707_high_29
Description: NF19707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19707_high_29 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 169 - 301
Target Start/End: Complemental strand, 49844 - 49712
Alignment:
| Q |
169 |
cattgtccggtgacttctagtcagatatgagatttttagtgaccgttccgggggttcattgttgcatagatgcaacaaaagggagtagggatgaatggaa |
268 |
Q |
| |
|
|||| |||| |||||||| ||||||||||||||||| |||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49844 |
cattctccgatgacttcttgtcagatatgagattttcagtgaccgtttcggaggttcattgttgcctagatgcaacaaaagggagtagggatgaatggaa |
49745 |
T |
|
| Q |
269 |
aagtacgtgatgagaagaaatcaagacttattg |
301 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||| |
|
|
| T |
49744 |
aagtacgtgatcagaagaactcaagacttattg |
49712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 50013 - 49917
Alignment:
| Q |
1 |
tctcgaacaatataagacacaaaatgatcttatctattttctttttataatccagaata-ctagatcattattttctttatcaattgtattgaatgg |
96 |
Q |
| |
|
|||| ||||||| |||||||||||| || ||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50013 |
tctccaacaataaaagacacaaaataatattatctattttctttttataatctagaatatctagatcattattttttttatcaattgtattgaatgg |
49917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University