View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19707_high_30 (Length: 264)
Name: NF19707_high_30
Description: NF19707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19707_high_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 21 - 226
Target Start/End: Original strand, 9165886 - 9166092
Alignment:
| Q |
21 |
atcaacggtatagtcaagctaattagttgt-ctacaaaatcagcacattgtacttagatgctataactcacgggttatccttatccaagctctactcaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9165886 |
atcaacggtatagtcaagctaattagttgtgctacgaaatcagcacattgtacttagatgctataactcacgggttatccttatccaagctctactcaag |
9165985 |
T |
|
| Q |
120 |
tcttgcgagcttatcggtctttcacttttaacagatttttgtgttagacaacttttaaacaatgtgttctcagattgtcctattagcagttttataatgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9165986 |
tcttgcgagcttatcggtctttcacttttaacagatttttgtgttagataacttttaaacaatatgttctcagattgtcctattagcagttttatgatgt |
9166085 |
T |
|
| Q |
220 |
atatggt |
226 |
Q |
| |
|
||||||| |
|
|
| T |
9166086 |
atatggt |
9166092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University