View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19707_high_31 (Length: 261)
Name: NF19707_high_31
Description: NF19707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19707_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 71 - 237
Target Start/End: Original strand, 5573736 - 5573902
Alignment:
| Q |
71 |
tatattcatgtccaacacgctttgaatagagggaacttataagaagnnnnnnnntgtaatattatatgtgtaaggaaagtagtttttcattgcctaaaaa |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5573736 |
tatattcatgtccaacacgctttgaatagagggaacttataagaagaaaaaaa-tgtaatattatatgtgtaaggaaagtagtttttcattgcctaaaaa |
5573834 |
T |
 |
| Q |
171 |
ataattccct-nnnnnnnnnnntggctaaaaaataatattatcacatgagaagataaaattttatcga |
237 |
Q |
| |
|
|| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5573835 |
atcattccctcaaaaaaaaaaatggctaaaaaataatattatcacatgagaagataaaattttatcga |
5573902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University