View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19707_high_34 (Length: 250)
Name: NF19707_high_34
Description: NF19707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19707_high_34 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 47681375 - 47681134
Alignment:
| Q |
9 |
caagaatataataatcaacacaagttacacaatcaattttccaataggtttcatatgcggctttctatagcattatcaatacaaaggtataattcttcaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47681375 |
caagaatataataatcaacacaagttacacaatcaattttccaataggtttcatatgcggctttctatagcattatcaatacaaaggtctaattcttcaa |
47681276 |
T |
|
| Q |
109 |
cttgtaaaatatgtaatttccacattcatcaatctaaaacatatgagtgattaaggtgaagattataaattttcagatatgaattttcaagaacatgagt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47681275 |
cttgtaaaatatgtaatttccacattcatcaatctaaaacatacgagtgattaaggtgaagattataaattttcagatatgagttttcaagaacatgagt |
47681176 |
T |
|
| Q |
209 |
gatttctgggttcaatggaacacttcaaaaaatttaaccaaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47681175 |
gatttctgggttcaatggaacacttcaaaaaatttaaccaaa |
47681134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University