View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19707_high_38 (Length: 246)
Name: NF19707_high_38
Description: NF19707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19707_high_38 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 42 - 246
Target Start/End: Complemental strand, 5574162 - 5573957
Alignment:
| Q |
42 |
tattcacaaatattgttgttgtcctttttgttcttt-atctagtcacataataatgttgcgtatattttataggaatttgattcctcaccaaacactatc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5574162 |
tattcacaaatattgttgttgtcctttttgttcttttatctagtcacataataatgttgcgtatattttataggaatttgattcctcaccaaacactatc |
5574063 |
T |
 |
| Q |
141 |
actgttctatggtaaaatcagtggtgttcccccacaaacatggacggtgccaaatatgcccacttactaatatttgcccataccacatttatcaattgtt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5574062 |
actgttctatggtaaaatcagtggtgttcccccacaaacatggacggtgccaaatatgcccacttactaatatttgcccataccacatttatcaattggt |
5573963 |
T |
 |
| Q |
241 |
cgtgtt |
246 |
Q |
| |
|
|||||| |
|
|
| T |
5573962 |
cgtgtt |
5573957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University