View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19707_high_45 (Length: 229)
Name: NF19707_high_45
Description: NF19707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19707_high_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 30495084 - 30495287
Alignment:
| Q |
1 |
tgatttcctcttatgattagtcttttgatcaatgcttgagtagatgatagcaaaatgttaaaactttaagtgcttaagtttttcatttttaatttgatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30495084 |
tgatttcctcttatgattagtcttttgatcaatacttgagtagatgatagcaaaatgttaaaactttaagtgcttaagtttttcatttttaatttgatgg |
30495183 |
T |
|
| Q |
101 |
gatagaaatacatcgtctcagtgattttaaatagcggtgctatagcgctatagcatatggaatttgaacaatttgttaaattgctatttgtgattcgcga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30495184 |
gatagaaatacatcgtctcagtgattttaaatagcggtgctatagcgctatagcatatggaatttgaacaatttgctaaattgctatttgtgattcgcga |
30495283 |
T |
|
| Q |
201 |
ttga |
204 |
Q |
| |
|
|||| |
|
|
| T |
30495284 |
ttga |
30495287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University