View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19707_low_14 (Length: 416)
Name: NF19707_low_14
Description: NF19707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19707_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 5e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 253 - 402
Target Start/End: Complemental strand, 39295490 - 39295341
Alignment:
| Q |
253 |
acatgtatctcatccataatcaagcaaaccctattttatttcacaataacattatgcatccatccttcaatgtcaactattcataatataaagttagtga |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39295490 |
acatgtatctcatccataatcaagcaaaccctattttatttcacaataacattatgcatccatccttcaatgtcaactattcataatataaagttggtga |
39295391 |
T |
|
| Q |
353 |
cctagtgtctttggactacaagcgtcgtgtgtcaaacgtgtcatactatt |
402 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
39295390 |
cctagtgtctttggactacaagcggcgtgcgtcaaacgtgtcatactatt |
39295341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 122 - 259
Target Start/End: Complemental strand, 39295872 - 39295735
Alignment:
| Q |
122 |
gtgattgtgagaactcgtatttaatcctcctttggtgagagtttcttggttgttctttgtagttttttcttggttatttctcttctgcgttttcatcgga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39295872 |
gtgattgtgagaactcgtatttaatcctcctttggtgagagtttcttggttgttctttgtagttttttcttggttatttctcttatgcgttttcatcgga |
39295773 |
T |
|
| Q |
222 |
ctacaagtggcgccccacttgtcatacccttacatgta |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39295772 |
ctacaagtggcgccccacttgtcatacccttacatgta |
39295735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University