View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19707_low_18 (Length: 380)
Name: NF19707_low_18
Description: NF19707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19707_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 19 - 366
Target Start/End: Original strand, 43797790 - 43798137
Alignment:
| Q |
19 |
gagttcaccgtttctgcagcctatcatttgttatgcaatcccaattatgatgattcgaggaataaatttagaaaattcaggtgcaagaaaaattaaattc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43797790 |
gagttcaccgtttctgcagcctatcatttgttatgcaatcccaattatgatgattcgaggaataaatttagaaaattcaggtgcaagaaaaattaaattc |
43797889 |
T |
 |
| Q |
119 |
tctttattgattcggaagttgtggtgaaaaatttaaagggatgtaatcctactagtgtagtgggttggtgcttaattaacaagattcttagtttgctttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43797890 |
tctttattgattcggaagttgtggtgaaaaatttaaagggatgtaatcctactagtgtagtgggttggtgcttaattaacaagattcttagtttgcttgc |
43797989 |
T |
 |
| Q |
219 |
gatggattgggaggttagagtttgtgactagtattgtgcagctaattgatgtgtttatgctcttgttaatatggggtgcgatagcgaggacgcttgaata |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43797990 |
gatggattgggaggttagagtttgtgactagtattgtgcagctaattaatgtgtttatgctcttgttaatatggggtgcgatagcgaggacgcttgaata |
43798089 |
T |
 |
| Q |
319 |
ctttttgagttatgtcttgttcaaactagttggttcgtcattattgat |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43798090 |
ctttttgagttatgtcttgttcaaactagttggttcgtcattattgat |
43798137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University