View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19707_low_30 (Length: 315)
Name: NF19707_low_30
Description: NF19707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19707_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 189 - 298
Target Start/End: Original strand, 28730944 - 28731053
Alignment:
| Q |
189 |
gttaggtggtagtggagttagtttatttggagtttctttgaagggatattatatgcggtatgtttgttagatgttttgttgaatttgaatcaaggatcca |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28730944 |
gttaggtggtagtggagttagtttatttggagtttctttgaagggatattatatgcggtatgtttgttagatgtttagttgaatttgaatcaaggatcca |
28731043 |
T |
|
| Q |
289 |
atgtggtcat |
298 |
Q |
| |
|
|||||||||| |
|
|
| T |
28731044 |
atgtggtcat |
28731053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 9 - 100
Target Start/End: Original strand, 28730764 - 28730855
Alignment:
| Q |
9 |
tatcattgatgtttgctgctggtccatcaagtgtagtaccattgtacttgagtaaaagggaggaaaggtctaaataaatttgggttcataac |
100 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28730764 |
tatcattgttgtttgttgctggtccatcaagtgtagtaccattgtacttgagtaaaagggaggaaaggtctaaataaatttggtttcataac |
28730855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 193 - 235
Target Start/End: Complemental strand, 40586617 - 40586575
Alignment:
| Q |
193 |
ggtggtagtggagttagtttatttggagtttctttgaagggat |
235 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| |||||||||| |
|
|
| T |
40586617 |
ggtggtagtggagtttgtttacttggagtttccttgaagggat |
40586575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University