View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19707_low_33 (Length: 270)
Name: NF19707_low_33
Description: NF19707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19707_low_33 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 130 - 270
Target Start/End: Original strand, 30494955 - 30495095
Alignment:
| Q |
130 |
gcaggatcctatcaggagttttagtggtcgtgaaaagtataagagacctctatgggcaatcactgcacttgaaaacccatctgtggtgagtttaaattat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30494955 |
gcaggatcctatcaggagttttagtggtcgtgaaaagtataagagacctctatgggcaatcactgcacttgaaaacccatctgtggtgagtttaaattat |
30495054 |
T |
|
| Q |
230 |
gattagtctatgaagcaatagggattatgtgatttcctctt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30495055 |
gattagtctatgaagcaatagggattatgtgatttcctctt |
30495095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 14 - 58
Target Start/End: Original strand, 30494837 - 30494881
Alignment:
| Q |
14 |
gaacctgtgctgtttctgtcacttacaaggtatttataatttctc |
58 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30494837 |
gaacctatgctgtttctgtcacttacaaggtatttataatttctc |
30494881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University