View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19707_low_37 (Length: 253)
Name: NF19707_low_37
Description: NF19707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19707_low_37 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 24889855 - 24890108
Alignment:
| Q |
1 |
agaaaatagggagagaagtgaacgtgaatgaaggtgggatcacatgaaactgaaagggttggatttggatttagcgttgggattgcaaaatatggagata |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24889855 |
agaaaatagtgagagaagtgaacgtgaatgaaggtgggatcacatgaaactgaaagggttggatttggatttagcgttgggattgcaaaatatggagata |
24889954 |
T |
|
| Q |
101 |
aaagaacagtagtgtaggatcctagtcctagatagaagatagttttggaacggtgggaaggtggacacgtggttggttctatggagtaggtagcaatggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24889955 |
aaagaacagtagtgtaggatcctagtcctagatagaagatagttttggaacggtgagaaggtggacacgtggttggttctatggagtcggtagcaatggg |
24890054 |
T |
|
| Q |
201 |
aagaaattttttgtccc-gtaatcataactcagttgacaaagacatgcattgtt |
253 |
Q |
| |
|
|||||| |||||||||| |||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
24890055 |
aagaaaatttttgtcccggtaagcataactcagttgacaaggacatgcattgtt |
24890108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 250
Target Start/End: Complemental strand, 3465945 - 3465909
Alignment:
| Q |
214 |
tcccgtaatcataactcagttgacaaagacatgcatt |
250 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||| |
|
|
| T |
3465945 |
tcccgtgaacataactcagttgacaaagacatgcatt |
3465909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University