View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19707_low_52 (Length: 222)
Name: NF19707_low_52
Description: NF19707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19707_low_52 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 7711335 - 7711539
Alignment:
| Q |
1 |
aaacaatcttaaagtgcatttttaaagaatttcaaacaatttaaggctagaccattttgttgtttctctacacgtctaatccgaggagggtctctgcttc |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||| |||||| |
|
|
| T |
7711335 |
aaacaatcttaaagtacatttttaaagaatttcaaacaatttaaggctagaccgttttgttgtttctctacacgtttaatccgaggaggatctatgcttc |
7711434 |
T |
|
| Q |
101 |
atagtatgaaactctttattgtgcaatcaatgactgtatgtaatttgtatcgtaatatttaaacacaacttgcactcgttaatccaaagtattgcataat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7711435 |
atagtatgaaactctttattgtgcaatcaatgactataagtaatttgtatcgtaatatttaaacacaacttgcactcgttaatccaaagtattgcataat |
7711534 |
T |
|
| Q |
201 |
agaat |
205 |
Q |
| |
|
||||| |
|
|
| T |
7711535 |
agaat |
7711539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 70 - 120
Target Start/End: Original strand, 1433544 - 1433594
Alignment:
| Q |
70 |
acacgtctaatccgaggagggtctctgcttcatagtatgaaactctttatt |
120 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||| ||||||||||| |
|
|
| T |
1433544 |
acacgtctaatccgaggagtgtccgtgcttcatagcatgtaactctttatt |
1433594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 106
Target Start/End: Complemental strand, 30103331 - 30103295
Alignment:
| Q |
70 |
acacgtctaatccgaggagggtctctgcttcatagta |
106 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
30103331 |
acacatctaatccgaggagtgtctctgcttcatagta |
30103295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University