View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19707_low_56 (Length: 209)
Name: NF19707_low_56
Description: NF19707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19707_low_56 |
 |  |
|
| [»] scaffold0329 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 192
Target Start/End: Complemental strand, 49732 - 49556
Alignment:
| Q |
16 |
agaagaaatcaagacttattggagtttgtttatggcgtttgaaaagtctatgaggatggttgaacaatggatatttggaaggtgtataaattttcatgcc |
115 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
49732 |
agaagaactcaagacttattggagtttgtttatggcgtttgaaaagtctatgaggatggttgagcaatggatatttggaaggtgtataaattttcatacc |
49633 |
T |
 |
| Q |
116 |
atgagccgtgcatgtcaccaccctgatggtctggtttgtgttactaatgagacatgggaatttaagagccacattct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
49632 |
atgagccgtgcatgtcaccaccctgatggtctggtttgtgttactaatgagacatgagagtttaagagccacattct |
49556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0329 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0329
Description:
Target: scaffold0329; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 33 - 133
Target Start/End: Original strand, 16492 - 16591
Alignment:
| Q |
33 |
attggagtttgtttatggcgtttgaaaagtctatgaggatggttgaacaatggatatttggaaggtgtataaattttcatgccatgagccgtgcatgtca |
132 |
Q |
| |
|
||||||||||||||||||| || || || || ||||||| ||| |||||||||| ||||||| |||||| | |||||||| |||||| ||| | ||||| |
|
|
| T |
16492 |
attggagtttgtttatggctttggaggagactttgaggat-gttaaacaatggatgtttggaatgtgtatgagttttcatgtcatgagtcgttcttgtca |
16590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 33 - 114
Target Start/End: Complemental strand, 19287733 - 19287652
Alignment:
| Q |
33 |
attggagtttgtttatggcgtttgaaaagtctatgaggatggttgaacaatggatatttggaaggtgtataaattttcatgc |
114 |
Q |
| |
|
|||||||||| |||||||| || || ||||| ||||||||||| |||||||||| | || || |||||| | ||||||||| |
|
|
| T |
19287733 |
attggagtttatttatggctttggaggagtctttgaggatggttaaacaatggatgtgtgaaatgtgtatgagttttcatgc |
19287652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University