View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19709_high_10 (Length: 261)
Name: NF19709_high_10
Description: NF19709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19709_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 25965681 - 25965912
Alignment:
| Q |
13 |
aatattctcaagtgtgtcttttgttagttatattatggattactccaattgttgaatgagtgaccagctttcaaaaggggtcatgtctgcttctgtcaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25965681 |
aatattctcaagtgtgtcttttgttagtaatattatggattactccaattgttgaatgattgaccagctttcaaaaggggtcatgtctgcttctgtcaga |
25965780 |
T |
 |
| Q |
113 |
nnnnnnngttttgcagcatttcaaagttactggcaggcctagattgtctgatagaatcaccgaagttagatggaagcctccagattggagatggataaaa |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
25965781 |
tttttttgttttgtagcatttcaaagttactggcaggcctagattgtctgatagaatcaccgaagttagatggaagcctctaga-tggagatggataaaa |
25965879 |
T |
 |
| Q |
213 |
gtggacactgatggctcatccattggttcacct |
245 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
25965880 |
gtggacactgatggctcatcaattggttcacct |
25965912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University