View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19709_high_11 (Length: 255)
Name: NF19709_high_11
Description: NF19709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19709_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 228
Target Start/End: Original strand, 28883514 - 28883729
Alignment:
| Q |
14 |
agagagggaaaccaattctgttgcaatttatgaacaagaaataacgagatccggatacacgtttatgacagaagtgggccccatcgaaagtagca-attt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
28883514 |
agagagggaaaccaattctgttgcaatttatgaacaagaaataacgagatccggatccacgtttattacagaagtgggccccatcgaaagtagcagattt |
28883613 |
T |
|
| Q |
113 |
catttcaatttcaatctgcattgataaacaaaaccggaacagaattttccgtcaccgacgaagatgctgccaaatctccgatcccggcgacgcccccgtt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28883614 |
catttcaatttcaatctgcattgataaacaaaaccgcaacagaattttccgtcaccgacgaagatgctgccaaatctccgatcccggcgacgcccccgtt |
28883713 |
T |
|
| Q |
213 |
acggaggccttctatg |
228 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
28883714 |
acggcagccttctatg |
28883729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University