View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19709_high_16 (Length: 238)
Name: NF19709_high_16
Description: NF19709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19709_high_16 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 39058921 - 39058704
Alignment:
| Q |
18 |
aggttttcttcaactcagctgcagagcaagagcaaagcaaaatcaatcaacgcagcagtagacgacacatggatgaaggagaaatagggaagaataaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39058921 |
aggttttcttcaactcagctgcagagcaagagcaaagcaaaatcaatcaacgcagcagtagacgacacatggatgaag---aaatagggaagaataaatt |
39058825 |
T |
|
| Q |
118 |
ggaactgcaactaagcctatagtattgcctaatatgttgagttcaagaagtttatcaagagtttgagattgagaactagctcaaatccaaaaaggggagt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39058824 |
ggaactgcaactaagcctatagtattgcctaatatgttgagttcaagaagtttatcaagagtttgagattgagaactagctcaaatccaaaaaggggagt |
39058725 |
T |
|
| Q |
218 |
cttgttactgatttgacttgc |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39058724 |
cttgttactgatttgacttgc |
39058704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University