View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19709_high_20 (Length: 215)

Name: NF19709_high_20
Description: NF19709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19709_high_20
NF19709_high_20
[»] chr4 (2 HSPs)
chr4 (17-196)||(56387805-56387984)
chr4 (42-173)||(29732705-29732836)


Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 56387805 - 56387984
Alignment:
17 cataggatctaacgaaggagacgaattcatcaagaggaggtttaggggtttgtaaactgagagagcgaaaggaattattgttgaatttgccagaggcatc 116  Q
    ||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
56387805 cataggatctaacgaaggagatgaattcatcaagaggaggtttaggtgtttgtaaactgagagagcgaaaggaattattgttgaatttgccagaggcatc 56387904  T
117 agtatcggcaacgtagttccatctacggccatcgatttgttcgcagcagatgaatctgctgctgccgatgaagttagtat 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||    
56387905 agtatcggcaacgtagttccatctacggccatcgatttgttcgcaacagatgaatctgctgctgccgatgaaggtagtat 56387984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 42 - 173
Target Start/End: Complemental strand, 29732836 - 29732705
Alignment:
42 ttcatcaagaggaggtttaggggtttgtaaactgagagagcgaaaggaattattgttgaatttgccagaggcatcagtatcggcaacgtagttccatcta 141  Q
    ||||||||||||||| || ||||||||||| ||||||||||||||||||||||| |||||||  || |||||||  || || || ||||| ||||||| |    
29732836 ttcatcaagaggaggctttggggtttgtaagctgagagagcgaaaggaattattcttgaattgcccggaggcattggtctctgccacgtaattccatcga 29732737  T
142 cggccatcgatttgttcgcagcagatgaatct 173  Q
    |||||||||||||  |||||||||||||||||    
29732736 cggccatcgatttcctcgcagcagatgaatct 29732705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University