View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19709_high_20 (Length: 215)
Name: NF19709_high_20
Description: NF19709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19709_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 56387805 - 56387984
Alignment:
| Q |
17 |
cataggatctaacgaaggagacgaattcatcaagaggaggtttaggggtttgtaaactgagagagcgaaaggaattattgttgaatttgccagaggcatc |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56387805 |
cataggatctaacgaaggagatgaattcatcaagaggaggtttaggtgtttgtaaactgagagagcgaaaggaattattgttgaatttgccagaggcatc |
56387904 |
T |
|
| Q |
117 |
agtatcggcaacgtagttccatctacggccatcgatttgttcgcagcagatgaatctgctgctgccgatgaagttagtat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
56387905 |
agtatcggcaacgtagttccatctacggccatcgatttgttcgcaacagatgaatctgctgctgccgatgaaggtagtat |
56387984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 42 - 173
Target Start/End: Complemental strand, 29732836 - 29732705
Alignment:
| Q |
42 |
ttcatcaagaggaggtttaggggtttgtaaactgagagagcgaaaggaattattgttgaatttgccagaggcatcagtatcggcaacgtagttccatcta |
141 |
Q |
| |
|
||||||||||||||| || ||||||||||| ||||||||||||||||||||||| ||||||| || ||||||| || || || ||||| ||||||| | |
|
|
| T |
29732836 |
ttcatcaagaggaggctttggggtttgtaagctgagagagcgaaaggaattattcttgaattgcccggaggcattggtctctgccacgtaattccatcga |
29732737 |
T |
|
| Q |
142 |
cggccatcgatttgttcgcagcagatgaatct |
173 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |
|
|
| T |
29732736 |
cggccatcgatttcctcgcagcagatgaatct |
29732705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University