View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19709_low_11 (Length: 261)

Name: NF19709_low_11
Description: NF19709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19709_low_11
NF19709_low_11
[»] chr5 (1 HSPs)
chr5 (13-245)||(25965681-25965912)


Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 25965681 - 25965912
Alignment:
13 aatattctcaagtgtgtcttttgttagttatattatggattactccaattgttgaatgagtgaccagctttcaaaaggggtcatgtctgcttctgtcaga 112  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
25965681 aatattctcaagtgtgtcttttgttagtaatattatggattactccaattgttgaatgattgaccagctttcaaaaggggtcatgtctgcttctgtcaga 25965780  T
113 nnnnnnngttttgcagcatttcaaagttactggcaggcctagattgtctgatagaatcaccgaagttagatggaagcctccagattggagatggataaaa 212  Q
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||    
25965781 tttttttgttttgtagcatttcaaagttactggcaggcctagattgtctgatagaatcaccgaagttagatggaagcctctaga-tggagatggataaaa 25965879  T
213 gtggacactgatggctcatccattggttcacct 245  Q
    |||||||||||||||||||| ||||||||||||    
25965880 gtggacactgatggctcatcaattggttcacct 25965912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University