View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19709_low_13 (Length: 252)
Name: NF19709_low_13
Description: NF19709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19709_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 39916071 - 39915870
Alignment:
| Q |
18 |
catatagtaagaattaatacttattgaagcaaagctgtgtctttgtcattccatttatgatattat-cagcatgtgtgccgccatgcattccgatctatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39916071 |
catatagtaagaattaatacttattgaagcaaagctgtgtctttgtcattccatttatgatattattcagcatgtgtgccgccatgcattccgatctatc |
39915972 |
T |
 |
| Q |
117 |
acacaccttagcttctttagttgcttctaaacttcccctacatttatttcatttaattaatttaattaagtacta----ctatagtatttgtcttccttc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39915971 |
acacaccttagcttctttagttgcttctaaacttcccctacatttatttcatttaattaatttaattaagtactactagctatagtatttgtcttccttc |
39915872 |
T |
 |
| Q |
213 |
ct |
214 |
Q |
| |
|
|| |
|
|
| T |
39915871 |
ct |
39915870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University