View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19709_low_14 (Length: 250)
Name: NF19709_low_14
Description: NF19709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19709_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 21838475 - 21838377
Alignment:
| Q |
1 |
aagacctcaaaatcttttatattgcggacgacaattgaaaaccaggcctctcatagctgggttttgcagggtaaaaagcttgcaactgctaactagagg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21838475 |
aagacctcaaaatcttttatattgcggacgacaattgaaaaccaggcctctcatagctgggttttgcagggaaaaaagcttgcaactgctaactagagg |
21838377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 133 - 204
Target Start/End: Complemental strand, 21838343 - 21838272
Alignment:
| Q |
133 |
gaaaggatagaggttttatatattaattgtcagctttatctatccatagtattttacaaccttaaagaagtt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21838343 |
gaaaggatagaggttttatatattaattgtcagctttatttatccatagtattttacaaccttaaagaagtt |
21838272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 2 - 31
Target Start/End: Original strand, 10978561 - 10978590
Alignment:
| Q |
2 |
agacctcaaaatcttttatattgcggacga |
31 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10978561 |
agacctcaaaatcttttatattgcggacga |
10978590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University