View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19709_low_22 (Length: 222)

Name: NF19709_low_22
Description: NF19709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19709_low_22
NF19709_low_22
[»] chr7 (1 HSPs)
chr7 (51-212)||(44001843-44002004)


Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 51 - 212
Target Start/End: Original strand, 44001843 - 44002004
Alignment:
51 gggtttggaagtttaagtgagatagaaaattatatatgatggttgaggttattttgaaatgaaatggtggtaaatgagagtatttataggaactaactta 150  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44001843 gggtttggaagtttaagtgagatagaaaattatatatgatggttgaggttattttgaaatgaaatggtggtaaatgagagtatttataggaactaactta 44001942  T
151 ggaagcacattgaaaagagtttgtgcttttacgatactcaataagtgtgtgatattcttcga 212  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |||||    
44001943 ggaagcacattgaaaagaggttgtgcttttacgatactcaataagtgtgtgattttattcga 44002004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University