View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19709_low_22 (Length: 222)
Name: NF19709_low_22
Description: NF19709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19709_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 51 - 212
Target Start/End: Original strand, 44001843 - 44002004
Alignment:
| Q |
51 |
gggtttggaagtttaagtgagatagaaaattatatatgatggttgaggttattttgaaatgaaatggtggtaaatgagagtatttataggaactaactta |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44001843 |
gggtttggaagtttaagtgagatagaaaattatatatgatggttgaggttattttgaaatgaaatggtggtaaatgagagtatttataggaactaactta |
44001942 |
T |
 |
| Q |
151 |
ggaagcacattgaaaagagtttgtgcttttacgatactcaataagtgtgtgatattcttcga |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
44001943 |
ggaagcacattgaaaagaggttgtgcttttacgatactcaataagtgtgtgattttattcga |
44002004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University