View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19709_low_6 (Length: 327)
Name: NF19709_low_6
Description: NF19709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19709_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 10 - 198
Target Start/End: Complemental strand, 36617844 - 36617656
Alignment:
| Q |
10 |
agcagagatgactggtcctgttgatttcaacaaaagtctggagtattggcagcaagacaagtggatgggctgttttcctttgaagtggcacattgttaag |
109 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36617844 |
agcagagatgaccggtcctgttgatttcaacaaaagtctggagtattggcagcaagacaagtggatgggctgttttcctttgaagtggcacattgttaag |
36617745 |
T |
 |
| Q |
110 |
gatgttcctaacaacgttttgaggcacattacattggaaaacaatgagaacaaacctgtcaccaacagtcgggatacacaggagataat |
198 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36617744 |
gatgttcctaacaacgtgttgaggcacattacattggaaaacaatgagaacaaacctgtcaccaacagtcgggatacacaggaggtaat |
36617656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 192 - 309
Target Start/End: Complemental strand, 36617581 - 36617464
Alignment:
| Q |
192 |
agataatgttggagccaggtctgaagctgctcaaaatttttaaggaatactcgagcaagacatgcattctggatgattttgggttctatgagggccgtca |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36617581 |
agataatgttggagccaggtctgaagctgctcaaaatttttaaggaatactcgagcaagacatgcattctggatgattttgggttctatgagggccgtca |
36617482 |
T |
 |
| Q |
292 |
gaagactattttggagaa |
309 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36617481 |
gaagactattttggagaa |
36617464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 14 - 193
Target Start/End: Complemental strand, 33126170 - 33125991
Alignment:
| Q |
14 |
gagatgactggtcctgttgatttcaacaaaagtctggagtattggcagcaagacaagtggatgggctgttttcctttgaagtggcacattgttaaggatg |
113 |
Q |
| |
|
|||||||||||||| |||||||| | |||| | | |||||||||||||| || | ||||| || || ||| | |||||||||| || |||||||| |
|
|
| T |
33126170 |
gagatgactggtccggttgattttgataaaactgtagagtattggcagcaggataggtggactggttgctttaatgtgaagtggcatatcattaaggata |
33126071 |
T |
 |
| Q |
114 |
ttcctaacaacgttttgaggcacattacattggaaaacaatgagaacaaacctgtcaccaacagtcgggatacacaggag |
193 |
Q |
| |
|
|||| ||| || || |||||||| ||| | ||||||||||| ||||||||||| || || || ||||||| |||||| |
|
|
| T |
33126070 |
ttccaaacggtgtgttaaggcacataacactagaaaacaatgaaaacaaacctgtaactaatagcagggatactcaggag |
33125991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University