View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1970_high_32 (Length: 227)
Name: NF1970_high_32
Description: NF1970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1970_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 214
Target Start/End: Original strand, 33033721 - 33033921
Alignment:
| Q |
14 |
ataggtgatgaacttaggctccagtctccctagaaaccaatcatattcaagtaaggtcgtatccgatgtcctctctggtatataaatttttgttaaatct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33033721 |
ataggtgatgaacttaggctccagtctccctagaaaccaatcatattcaagtaaggtcgtatccgatgtcctctctggtatataaatttttgttaaatct |
33033820 |
T |
 |
| Q |
114 |
taaactctcaatgcaggactgactcggttgatgtctacactggttctatagatgaagtaataactttcttgtcgcaggccagtcatagtttggcaaaatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33033821 |
taaactctcaatgcaggactgactcggttgatgtctacactggttctatagatgaagtaataactttcttgtcgcaggccagtcatagtttggcaaaatg |
33033920 |
T |
 |
| Q |
214 |
t |
214 |
Q |
| |
|
| |
|
|
| T |
33033921 |
t |
33033921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 70
Target Start/End: Original strand, 33033256 - 33033312
Alignment:
| Q |
14 |
ataggtgatgaacttaggctccagtctccctagaaaccaatcatattcaagtaaggt |
70 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| ||| | |||||| ||||| |
|
|
| T |
33033256 |
ataggtgatgaacttaggttcctgtctccctagaaaccgatcctgttcaagcaaggt |
33033312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University