View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1970_low_15 (Length: 332)
Name: NF1970_low_15
Description: NF1970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1970_low_15 |
 |  |
|
| [»] scaffold0543 (1 HSPs) |
 |  |  |
|
| [»] scaffold0492 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 17 - 135
Target Start/End: Original strand, 34356513 - 34356631
Alignment:
| Q |
17 |
caaaggaaagaatataataaagaagtgaatcaggtagagcacttattttgtcttcccctaaaattgaacaacaagaatcacatcaaaaccaaattttatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34356513 |
caaaggaaagaatataataaagaagtgaatcaggtagagcacttattttatcttcccctgaaattgaacaacaagaatcacatcaaaaccgaattttatg |
34356612 |
T |
 |
| Q |
117 |
taaattttatcacggtaat |
135 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34356613 |
taaattttatcacggtaat |
34356631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 18 - 115
Target Start/End: Complemental strand, 35047225 - 35047128
Alignment:
| Q |
18 |
aaaggaaagaatataataaagaagtgaatcaggtagagcacttattttgtcttcccctaaaattgaacaacaagaatcacatcaaaaccaaattttat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35047225 |
aaaggaaagaatataataaagaagtgaatcaggtagcgcacttattttgtcttctcctggaattgaacaaggagaatcacatcaaaaccaaattttat |
35047128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 283 - 316
Target Start/End: Original strand, 34356628 - 34356661
Alignment:
| Q |
283 |
taataaaaagtaagaacaaacacttgactaagct |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34356628 |
taataaaaagtaagaacaaacacttgactaagct |
34356661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0543 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0543
Description:
Target: scaffold0543; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 84
Target Start/End: Original strand, 3919 - 3981
Alignment:
| Q |
22 |
gaaagaatataataaagaagtgaatcaggtagagcacttattttgtcttcccctaaaattgaa |
84 |
Q |
| |
|
|||||||| | ||||||||||||||| ||||||||||| ||| ||||||| ||| ||||||| |
|
|
| T |
3919 |
gaaagaatgtgataaagaagtgaatccggtagagcactgattctgtcttctcctggaattgaa |
3981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0492
Description:
Target: scaffold0492; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 84
Target Start/End: Original strand, 5465 - 5527
Alignment:
| Q |
22 |
gaaagaatataataaagaagtgaatcaggtagagcacttattttgtcttcccctaaaattgaa |
84 |
Q |
| |
|
|||||||| | ||||||||||||||| ||||||||||| ||| ||||||| ||| ||||||| |
|
|
| T |
5465 |
gaaagaatgtgataaagaagtgaatccggtagagcactgattctgtcttctcctggaattgaa |
5527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University