View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1970_low_25 (Length: 258)
Name: NF1970_low_25
Description: NF1970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1970_low_25 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 258
Target Start/End: Complemental strand, 4376676 - 4376436
Alignment:
| Q |
17 |
aagttttctacgacca-ggaggtagaagttgcttgcaatgacaaggtttttgcttagcaaacaaattataaactatggttgagaaatggctttcagaatt |
115 |
Q |
| |
|
|||||| ||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4376676 |
aagtttgctacgaccaaggaggtagaagctgcttgcaatgagaaggtttttgcttagcaaacaaattataaactatggttgagaaatggctttcagaatt |
4376577 |
T |
 |
| Q |
116 |
ataggtcatctatcaagtatagcaacatatggagggtacatcatgtttggtttgaaagctaagattaaaccgatgttgggtaagttaacaactctgtcat |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4376576 |
ataggtcatctatcaagta--gcaacatatggagggtacatcatgtttggtttgaaagctaagattaaaccgatgttgggtaagttaacaactctgtcat |
4376479 |
T |
 |
| Q |
216 |
cttcatatatgtatcttctttgttccatcttatttatttaagt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4376478 |
cttcatatatgtatcttctttgttccatcttatttatttaagt |
4376436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University