View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1970_low_30 (Length: 252)
Name: NF1970_low_30
Description: NF1970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1970_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 235
Target Start/End: Original strand, 35808477 - 35808700
Alignment:
| Q |
12 |
tgagatgaagaactgtgacttaaattatcactgaagtcactgcaagtgaaaaactcaggaaaaggtggcaaactaacatttgaattcatcatatcattgg |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808477 |
tgagacgaagaactgtgacttaaattatcactgaagtcactgcaagtgaaaaactcaggaaaaggtggcaaactaacatttgaattcatcatatcattgg |
35808576 |
T |
 |
| Q |
112 |
aaaaagaagaagtaggagtagcagcagccgcagcgcaacgagccagacgatcctttgcaatggcaagatcatgttgaagttcaaccatcttcctttgcaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808577 |
aaaaagaagaagtaggagtagcagcagccgcagcgcaacgagccaggcgatcctttgcaatggcaagatcatgttgaagttcaaccatcttcctttgcaa |
35808676 |
T |
 |
| Q |
212 |
aagtgctatagcacctatgcatcc |
235 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35808677 |
aagtgctatagcacctatgcatcc |
35808700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 211
Target Start/End: Original strand, 32036245 - 32036309
Alignment:
| Q |
147 |
caacgagccagacgatcctttgcaatggcaagatcatgttgaagttcaaccatcttcctttgcaa |
211 |
Q |
| |
|
|||||||| ||||| ||||| |||||||| | |||||| |||||||| | ||||||||||||||| |
|
|
| T |
32036245 |
caacgagcaagacgttccttagcaatggccaaatcatgctgaagttccatcatcttcctttgcaa |
32036309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University