View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1970_low_41 (Length: 211)
Name: NF1970_low_41
Description: NF1970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1970_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 3429181 - 3429003
Alignment:
| Q |
17 |
acccctgtagttttgtccatcattgacaaagatattgacaaccttgtacttgttccaactacttccacttcacaagaaaatgaaggttcttgttcttcac |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429181 |
acccctgtagttttttccatcattgacaaagatattgacaaccttgtacttgttccaactacttccacttcacaagaaaatgaaggttcttgttcttcac |
3429082 |
T |
 |
| Q |
117 |
aacataggcagtgattgtgtttcactagctagttggttagtaaaatcatgtggtagatactagtggtaggtgttagtat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429081 |
aacataggcagtgattgtgtttcactagctagttggttagtaaaatcatgtggtagatactagtggtaggtgttagtat |
3429003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 17 - 172
Target Start/End: Complemental strand, 3425702 - 3425544
Alignment:
| Q |
17 |
acccctgtagttttgtccatcattgacaaagatattgacaaccttgtacttgttccaactacttccacttcacaagaaaatga---aggttcttgttctt |
113 |
Q |
| |
|
|||||||||||||||||||||||| |||| || |||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
3425702 |
acccctgtagttttgtccatcattaacaatgaaattgacaaccttgtacttgttccagctacttccacttcacaagaaaatgaagtaggttcttgctctt |
3425603 |
T |
 |
| Q |
114 |
cacaacataggcagtgattgtgtttcactagctagttggttagtaaaatcatgtggtag |
172 |
Q |
| |
|
|||||||||| || ||||||||||||| || |||||| ||| ||||| ||||||||||| |
|
|
| T |
3425602 |
cacaacatagacaatgattgtgtttcattacctagtttgttggtaaagtcatgtggtag |
3425544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University