View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19710_low_9 (Length: 220)
Name: NF19710_low_9
Description: NF19710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19710_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 16 - 202
Target Start/End: Original strand, 2704950 - 2705138
Alignment:
| Q |
16 |
attttattactctcacacatttgaaatc--ggaattatttaagaaaatatatnnnnnnn-gatttcatatgtatcttctttaagatattagaatatcgtc |
112 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||| || ||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
2704950 |
attttattactctcacacatttgaaatattggaattatttaa-aaaatatatataaaaaagacttcatatgtatctgcttgaagatattagaatatcgtc |
2705048 |
T |
 |
| Q |
113 |
aagtttttgatgaagtagccagtgggaatatctttttcttttgcatggaatagtccacacatctttaccaatttctgtttttatcaaata |
202 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
2705049 |
aagtttgtgatgaagtggccagtgggaatatctttttcttttgcatggaatagtccacacatctttgccaatttctttttttatcaaata |
2705138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 77 - 202
Target Start/End: Complemental strand, 14790070 - 14789945
Alignment:
| Q |
77 |
tcatatgtatcttctttaagatattagaatatcgtcaagtttttgatgaagtagccagtgggaatatctttttcttttgcatggaatagtccacacatct |
176 |
Q |
| |
|
|||||||||||| || ||||||||| |||||| |||||||| ||||||||| ||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14790070 |
tcatatgtatctgtttgaagatattaaaatatcatcaagtttgtgatgaagtgaccagtggaaatatctttttcttttgcattgaatagtccacacatct |
14789971 |
T |
 |
| Q |
177 |
ttaccaatttctgtttttatcaaata |
202 |
Q |
| |
|
|| ||||||||| ||||||||||||| |
|
|
| T |
14789970 |
ttgccaatttctttttttatcaaata |
14789945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University