View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19711_low_17 (Length: 247)
Name: NF19711_low_17
Description: NF19711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19711_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 10011097 - 10010868
Alignment:
| Q |
1 |
tattgaaagcatacagacaatggaaggagagaacttggtgttaaaaggaaagtagttgctgcatgtgcatggaaggtgttcgttttgtttacacctgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10011097 |
tattgaaagcatacagacaatggaaggagagaacttggtgttaaaaggaaagtagttgctgcatgtgcatggaaggtgttcgttttgtttacacctgttc |
10010998 |
T |
|
| Q |
101 |
ttatttgtttatcttttgtttacatattttcctaggttcaacaggttttaaaattgtttttctgaatattagagtatctgcgcgttgtgcgtgatggctg |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
10010997 |
ttatttggttatcttttgtttacatattttcctaggttcaacaggttttaaaattgtttctctgaatattagagtatctgagcgttgtgcgtgacggctg |
10010898 |
T |
|
| Q |
201 |
ttgtcagtgagaacggaatgtttggattta |
230 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |
|
|
| T |
10010897 |
ttgtcagtgagaacggaaagtttggattta |
10010868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 44
Target Start/End: Complemental strand, 561464 - 561424
Alignment:
| Q |
4 |
tgaaagcatacagacaatggaaggagagaacttggtgttaa |
44 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
561464 |
tgaaagcatacatacaattgaatgagagaacttggtgttaa |
561424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University