View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19712_low_5 (Length: 215)

Name: NF19712_low_5
Description: NF19712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19712_low_5
NF19712_low_5
[»] chr1 (1 HSPs)
chr1 (18-199)||(32376275-32376448)


Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 32376448 - 32376275
Alignment:
18 gtaacaatgattataaagtctctctggttacttgggctggttaggagattattggtgatgccgtgatgggatattggcatttaaaccgatttaaaataaa 117  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||        |||||||||||||||||||||| |||||||||||||    
32376448 gtaacaatgattataaagtctctctcgttacttgggctggttaggagattattggt--------gatgggatattggcatttaaactgatttaaaataaa 32376357  T
118 cctcaaatcgatccnnnnnnncttgaaaatcgctcaaacttaacatttatttgatgcttttgaaacaacccttcgtattcat 199  Q
    ||| |||||||||        |||||||||  ||||||||||||||||||||| ||||||||||||||||||||||||||||    
32376356 ccttaaatcgatcaaaaaaaacttgaaaattactcaaacttaacatttatttggtgcttttgaaacaacccttcgtattcat 32376275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University