View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19712_low_5 (Length: 215)
Name: NF19712_low_5
Description: NF19712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19712_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 32376448 - 32376275
Alignment:
| Q |
18 |
gtaacaatgattataaagtctctctggttacttgggctggttaggagattattggtgatgccgtgatgggatattggcatttaaaccgatttaaaataaa |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32376448 |
gtaacaatgattataaagtctctctcgttacttgggctggttaggagattattggt--------gatgggatattggcatttaaactgatttaaaataaa |
32376357 |
T |
 |
| Q |
118 |
cctcaaatcgatccnnnnnnncttgaaaatcgctcaaacttaacatttatttgatgcttttgaaacaacccttcgtattcat |
199 |
Q |
| |
|
||| ||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32376356 |
ccttaaatcgatcaaaaaaaacttgaaaattactcaaacttaacatttatttggtgcttttgaaacaacccttcgtattcat |
32376275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University