View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19713_high_21 (Length: 249)
Name: NF19713_high_21
Description: NF19713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19713_high_21 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 40650999 - 40650763
Alignment:
| Q |
13 |
tacttttggacttttgataaattgattattctaagttggatgagctaaggcaaatatatgaggaattgccagaattcctggaagaggtagctttgatgaa |
112 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40650999 |
tacttttggacttttgataaattggttattctaagttggatgagctaaggcaaatatatgaggaattgccagaattcctggaagaggtagctttgatgaa |
40650900 |
T |
 |
| Q |
113 |
aactctaaattctaattcattaaaacaaatatgctgtgtgtatttatcgtgatgcattttttgcaggtttcatcgttggaacttgcacaactccctgatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40650899 |
aactctaaattctaattcattaaaacaaatatgctgtgtgtattcatcgtgatacattttttgcaggtttcatcgttggaacttgcacaactccctgatc |
40650800 |
T |
 |
| Q |
213 |
tatgcaagaacaagcttgttccctgtattgtttatat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40650799 |
tatgcaagaacaagcttgttccctgtattgtttatat |
40650763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University