View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19713_high_25 (Length: 228)

Name: NF19713_high_25
Description: NF19713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19713_high_25
NF19713_high_25
[»] chr3 (2 HSPs)
chr3 (46-209)||(30885518-30885681)
chr3 (16-47)||(30885175-30885206)


Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 46 - 209
Target Start/End: Original strand, 30885518 - 30885681
Alignment:
46 gggctcaatacatgtgtgctcttttactgtcatggtgcagcatctattggctgctgctgatctctataatcttgacaggctaaaaatgttatgtgaatca 145  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30885518 gggctcaatacatgtgtgctcttttactgtcatggtgcagcatctattggctgctgctgatctctataatcttgacaggctaaaaatgttatgtgaatca 30885617  T
146 aaattgtgcgaagaaatcaatactgagaccgtagccacaacacttgccctggctgagcaacacc 209  Q
    |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
30885618 aaattgtgtgaagaaatcaatactgagaccgtagccacgacacttgccctggctgagcaacacc 30885681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 47
Target Start/End: Original strand, 30885175 - 30885206
Alignment:
16 atagggtgagttgtctctatcaaaataaacgg 47  Q
    ||||||||||||||||||||||||||||||||    
30885175 atagggtgagttgtctctatcaaaataaacgg 30885206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University