View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19713_high_27 (Length: 220)
Name: NF19713_high_27
Description: NF19713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19713_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 26640585 - 26640397
Alignment:
| Q |
19 |
aaccatggccataattctgccggaaaattgatttctaaatccagtcttgcaaacattgttaccaaagcaatctgcacatcaacggaaataatctatttag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26640585 |
aaccatggccataattctgccggaaaattgatttctaaatccagtcttgcaaacattgttaccaaagcaatctgcacatcaacggaaataatctatttag |
26640486 |
T |
|
| Q |
119 |
tattttatcaaagtctcattcttgactgcgttgataaaatggagtatgcagattatgcttgacnnnnnnntttatctgtaagaataatc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26640485 |
tattttatcaaagtctcattcttgactgcgttgataaaatggagtatgcagattatgcttgacaaaaaaatttatctgtaagaataatc |
26640397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University